Lightshift chemiluminescent emsa kit pdf

Can you please suggest to me which emsa kit is best for using. Biotin endlabeled dna containing the binding site of interest is incubated with a nuclear extract or purified factor. Competition emsas were carried out to compare the binding affinities of the polymorphic variants for relevant nuclear proteins by adding unlabelled oligonucleotides of varying. Promoter and intron 1 polymorphisms of col1a1 interact to. The lightshift chemiluminescent emsa kit has been utilized in my laboratory for approximately 6 months, and while we are still working out the binding assay parameters, the kit has provided extremely clean blots during the optimization process. Transcriptionalregulationofaqp8,a caenorhabditis elegans. Precautions for smc products me033 and the operation manual for actuator. Extracts obtained with the subcellular protein fractionation kit are compatible with a variety of downstream applications including western blotting, thermo scientific pierce bca protein assay product no. The emsa binding reactions were performed at room temperature using the lightshift chemiluminescent emsa kit pierce, usa according to the manufacturers instructions. Lightshift chemiluminescent emsa kit, contains components for 100 binding reactions and sufficient detection reagents for approximately cm2 of.

Nucleic acid binding protein an overview sciencedirect. This chemiluminescent western blot kit allows for the detection of primary goat polyclonal antibodies provided by the userimmunological assays are a biochemical test that measures the presence or concentration of a macromolecule or a small molecule in a solution through the use of an antibody or an antigen. The thermo scientific lightshift chemiluminescent emsa kit is an extraordinarily robust and sensitive system for performing electrophoretic mobility shift assays emsa to identify and characterize proteindna binding interactions. Labeling the probe for chemiluminescent emsa biocompare. Lightshift chemiluminescent emsa kit from pierce biocompare. The synthetic biotinylated oligonucleotides used in this study include the consensus octamer oligonucleotide, 5 attgccaaaatttgcatactggaat3 anditscomplement5 attccagtatgcaaattttggcaat3. The setd2 direct activity chemiluminescent assay kit is designed to measure setd2 activity for screening and profiling applications.

The principle for lightshift emsa detection is similar to a western. Immunocytochemistry for stat3 and stat5 localization immunocytochemistry was performed as described previously 37. Dilute oligonucleotide mixture to a final concentration of 1 pmoll with a tris or phosphate buffer containing salt. The thermo scientific biotin 3 end dna labeling kit uses tdt to incorporate biotinylated ribonucleotides onto the 3. Dna binding reactions, a control set of dna and protein extract to test the kit system, stabilized streptavidinhrp conjugate to probe for the biotinlabeled dna target, and an exceptionally sensitive chemiluminescent substrate module for detection. Electrophoretic mobility shift assay emsa by using biotins. The gelshift chemiluminescent emsa assay kit provides a simple, nonradioactive assay to identify proteindna binding with proven reagents. Lightshift emsa optimization and control kit 20148x. Emsa electrophoretic mobility shift assay was performed using the lightshift chemiluminescent emsa kit thermo scientific. The kit includes a biotinylated rna probe positive control, an unlabeled rna, cell extract source of rnabinding protein, 10x binding buffer and accessory binding buffer co mponents for optimization. Rabbit antiocti antibody 1 pg was added to a binding reaction containing a 22 bp octi specific biotinlabeled duplex and a. This products resides on a fisher scientific gsa or va contract. Immunological assays come in many different formats and variations, and may be run in. This method was simple, rapid and flexible, and can accomplish the whole assay including the preincubation, detection and regeneration steps within 16 min.

If stored properly, reagents have a shelflife of 6. Gel shift protocol for the lightshift chemiluminescent emsa kit anne hempel and ilsa leon, llinas lab 2007 anneal oligos 1. The thermo scientific lightshift chemiluminescent emsa kit uses a nonisotopic method to detect dnaprotein interactions. In this electrophoretic mobility shift assay emsa, cell extracts or purified factors are incubated with biotin end. Gels were transferred to positively charged nylon membranes and crosslinked using a uv transilluminator. Introduction of emsa gelshift technique 48 critical emsa reaction parameters 48 emsa applications 48 electrophoretic mobility shift assays 49 emsa or gelshifts lightshift chemiluminescent dna emsa kits 50 biotin 3. The kit includes reagents for setting up and customizing dna binding. End dna labeling kit 51 lightshift chemiluminescent rna electrophoretic 52 mobility shift assay rna biotinylation 54. The key to the setd2 chemiluminescent assay kit is a highly specific antibody that recognizes methylated k36 residue of histone h3. Emsa reactions were carried out using the lightshift chemiluminescent emsa kit pierce.

In this electrophoretic mobility shift assay emsa, cell extracts or purified factors are incubated with biotin endlabeled probe containing the consensus binding site of interest. Thermo scientific lightshift emsa optimization and. The gelshift chemiluminescent emsa kit provides a nonradioactive method to detect dna protein interactions. Biolayer interferometry assay bli for small molecule binding. The rna emsa kit uses biotinylated rna probes and a chemiluminescent substrate system to achieve fast and safe detection of rnaprotein complexes with. Dnanuclear extract binding reactions were performed as follows. Refer to the product insert for quantities and details of components supplied.

Gel shift protocol for the lightshift chemiluminescent emsa kit. C10557, c10558 introduction the camp chemiluminescent immunoassay kit is designed for the rapid and sensitive quantitation of 3,5cyclic amp camp in extracts prepared from mammalian cells cultured in microwell plates without the need for sample acetylation or standards. Electrophoretic mobility shift assay emsa by using biotins to detect proteindna interactions hao chen introduction electrophoretic mobility shift assay emsa is based on the simple rationale that proteins of differing size, molecular weight, and charge will have different electrophoretic mobilities in a nondenaturing gel matrix. Jun 28, 2016 emsa was performed using lightshift chemiluminescent emsa kit thermo fisher scientific inc. The gelshift chemiluminescent emsa kit includes biotinlabeled and unlabeled control dna as.

Electrophoretic mobility shift assay emsa gel swift assay was performed using lightshift chemiluminescent emsa kit thermo fisher according to the manufacturers instruction. The monitoring probe has dna sequence containing a ebox 5. End biotinylation kit 11 electrophoretic mobility shift assays emsa 20 introduction to the emsa gelshift technique critical emsa reaction parameters emsa applications 14 neper nuclear and cytoplasmic protein 15 extraction reagent kit lightshift chemiluminescent dna emsa kit 16. Nucleic acid binding protein an overview sciencedirect topics. Emsa was performed by using the lightshift chemiluminescent emsa kit thermo scientific, 20148x according to the manufacturers protocol. The thermo scientific lightshift chemiluminescent rna emsa kit contains reagents for performing nonradioactive emsas. The key to the setd2 chemiluminescent assay kit is a highly specific antibody that recognizes methylated k36 residue of hi. If the kit is being used for the first time, we recommend to run the control system reactions to verify the kit components and procedure are working properly. The lightshift emsa kit utilizes pierces patented supersignal chemiluminescent detection technology to offer detection levels rivaling that of.

Thanks in advance, bindusbinduthe exact times for developing depend on the type of film you. The lightshift chemiluminescent emsa kit pi20148 contains all reagents in the optimization and control kit pi20148x, plus additional reagents. For nonisotopic emsa applications, use the thermo scientific lightshift chemiluminescent emsa kit product no. For nonisotopic northern or southern blotting applications, use the thermo scientific north2south. Strip northern and southern blots fisher scientific. Chemiluminescent emsa how to develop xray film jul072011 hi friends, could someone please help me to get the protocol to develop xray film after doing emsa using the lightshift chemiluminescent emsa kit from thermo scientific. Membranes were visualised using the lightshift chemiluminescent emsa kit thermo scientific and image acquisition and analysis performed using a chemidocit camera system uvp. The basic helixloophelix transcription factor mdbhlh3. Biotin labeled oligonucleotide biog6 please see table 1 for sequences of biog6, g6 and mg was mixed with 0. Description the kit includes reagents for setting up and customizing protein. Proteindna complexes were resolved by polyacrylamide gel electrophoresis and detected using a lightshift chemiluminescent emsa kit to confirm whether any dnabinding proteins bind to the polymorphic site. Lightshift chemiluminescent dna emsa kit 16 lightshift chemiluminescent rna 18 electrophoretic mobility shift assay chromatin immunoprecipitation chip 2127 chip and epigenetics 21 chip and promoter profiling 21 chip assay procedure 22 using chip to profile the myc promoter 24.

Panomics emsa kit contents and storage conditions emsa gel shift user manual page 5 panomics emsa kit contents and storage conditions kit contents and storage the emsa kit contains the following components. Electrophoretic mobility shift assay bejerano lab, stanford. Allelic differences in nuclear protein binding at a genome. Mix concentrated complementary oligonucleotides together at a 1. Gelshift chemiluminescent emsa manual active motif. The thermo scientific lightshift emsa optimization and control kit is an extraordinarily robust and sensitive system for performing electrophoretic mobility shift assays emsa to identify and characterize proteindna binding interactions. The kit includes reagents for setting up and customizing dna. Thermo scientific lightshift chemiluminescent rna emsa kit. Guaninerich sequences inhibit proofreading dna polymerases. Mix 1 l of each forward and reverse oligo in 48 l of te to a final concentration of 20 fmol.

With this kit, only three simple steps on a microtiter plate are required for detection of demethylase activity. Poly didc, pi20148e is included in kits pi20148x and pi20148 or can be purchased separately. Lightshift chemiluminescent emsa kit thermo fisher scientific. This kit is used to label the probe which is used for chemiluminescent emsa.

The thermo scientific biotin 3 end dna labeling kit uses tdt to incorporate biotinylated ribonucleotides onto the 3 end of dna strands. Supplementary material targeted disruption of mycmax. Thermo scientific lightshift emsa optimization and control kit. The unlabeled nucleotides served as specific competitors to eliminate nonspecific nucleotideprotein interactions. Research article open access resveratrol attenuates. Basically, it uses tdt to incorporate the biotinylated ribonucleotides at the 3 ends of the dna strands which is further used in the binding reaction for performing emsa. Promoter and intron 1 polymorphisms of col1a1 interact to regulate transcription and susceptibility to osteoporosis. The thermo scientific lightshift chemiluminescent emsa kit is an extraordinarily robust and sensitive system for performing electrophoretic mobility shift assays. Emsa was performed using lightshift chemiluminescent emsa kit thermo fisher scientific inc. The key to the fto chemiluminescent assay kit is a highly specific antibody that recognizes methylated substrate. Shop online for a wide selection of thermo scientific lightshift emsa optimization and control kit identify and characterize proteindna binding interactions by. Electrophoretic mobility shift assays implicate xrcc2. Mar 14, 2007 the lightshift chemiluminescent emsa kit has been utilized in my laboratory for approximately 6 months, and while we are still working out the binding assay parameters, the kit has provided extremely clean blots during the optimization process.

Thermo scientific lightshift chemiluminescent rna emsa kit provides a nonradioactive solution for studying rnaprotein interactions using an electrophoretic mobilityshift assay emsa. Could someone please help me to get the protocol to develop xray film after doing emsa using the lightshift chemiluminescent emsa kit from thermo scientific. Thermo scientific lightshift emsa optimization and control. Regulation of rip3 by the transcription factor sp1 and the. Spin down the lyophilized oligos and resuspend in te buffer at 100 pmoll. Which kit or protocol is suitable for emsa assay in plant. Possible stripping conditions for northern and southern blots. See kit contents for a list of components in each kit.

350 1035 646 25 881 669 825 732 930 364 937 1096 735 798 1112 1100 274 1342 1546 245 1558 1292 1481 536 167 113 1105 1479 1551 830 1067 61 1611 741 174 1216 664 61 1422 1294 426 125 1030 995 578